Question: Can I detect T cells with gamma-delta chains in my V(D)J data?
Answer: The Cell Ranger multi pipeline can process TCR libraries enriched for gamma-delta (TRG/D) chains. Please note that TRG/D enrichment is not supported by 10x Genomics, as this workflow requires additional reagents and primers. Since the TRG/D workflow is not supported, the algorithm's performance cannot be guaranteed. Refer to the 10x Genomics support site for additional details.
Biological relevance
T cells express one of two T cell receptors (TCRs) on their cell membranes:
1) Alpha-beta (TRA/B) TCRs: are composed of variable alpha and beta chains. TRA/B are the more frequent chain type, expressed on a larger fraction of T cells.
2) Delta-gamma (TRG/D) TCRs: have variable delta and gamma chains. TRG/D are expressed on 0.5-5% of T cells.
Assay perspective
Single cell human TCR amplification kits (1000252/1000005) or mouse TCR amplification kits (1000254/1000071) target the constant region of T cell alpha-beta chains. These standard primers cannot be used to enrich TRG/D transcripts. While 10x Genomics does not officially support TRG/D, some customers have successfully used the Chromium Next GEM Single Cell 5' Assay kit to amplify TRG/D chains by designing custom primers.
Here is a list of publications that use the 10x Genomics Single Cell 5' Immune Profiling assay to detect TRG/D chains:
- Lee, M., Lee, E., Han, S.K. et al. Single-cell RNA sequencing identifies shared differentiation paths of mouse thymic innate T cells. Nat Commun 11, 4367 (2020). https://doi.org/10.1038/s41467-020-18155-8
- Mimitou, E.P., Cheng, A., Montalbano, A. et al. Multiplexed detection of proteins, transcriptomes, clonotypes and CRISPR perturbations in single cells. Nat Methods 16, 409–412 (2019). https://doi.org/10.1038/s41592-019-0392-0
- Gherardin, N. A., Waldeck, K., Caneborg, A. et al. γδ T cells in Merkel cell carcinomas have a proinflammatory profile prognostic of patient survival. Cancer Immunology Research 9, 612-623 (2021). https://doi.org/10.1158/2326-6066
PCR conditions used in the publications to amplify TRG/D from the cDNA generated using the Chromium instrument (5' v1.1 assay):
Please note that the forward primers for the 5' v2 assay should be different than listed in the table above. The forward primer used in the 5' v2 assay is 5’-GATCTACACTCTTTCCCTACACGACGC-3’ for both enrichment PCRs. Please also see the appendix of the 5' v2 userguide. Using incorrect forward primers (from the 5' v1.1 assay) will result in an amplification product that is not compatible with downstream 5' v2 library preparation.
Please note that the same recommendations are applicable for 5' v3 (GEM-X) as described above for 5' v2. The same TCR amplification kit is used for both 5' v2 and 5' v3.
For more information regarding the primers or the protocol, please contact the corresponding author of the respective publication.
The User Guide describes the assay scheme and configuration (with oligo sequence info and primer concentrations for target enrichment steps), which can be used for designing a custom assay. A guide for PCR conditions is available in section 3.1 of the User Guide linked above. If you plan to design your own primers, refer to the design of alpha-beta primers in the Appendix, for steps 4.1 and 4.3.
Please follow the best practices for primer design, including limiting GC content to 40-60%, and ensure that the melting temperatures of all the primers in a pool are within a similar range. Please note that the forward primer sequences for 5’ v1/v1.1 and 5’ v2 are different.
The recommended starting primer concentration range is 0.1 uM to 1 uM. The forward primer for 5’ v2 was shortened to accommodate dual-indexing. Forward and reverse primer concentrations may need to be reduced for optimal v2 performance. After recognizing a few viable primer options, search for each primer in your genome of interest. We recommend selecting a primer that has minimal interaction with other regions of the genome.
QC
A sharp peak between 500 and 700 bp should be present which corresponds to V(D)J transcripts. The appearance of the enrichment trace is very sample-type specific and some variation is normal. (Please see: Why does my V(D)J enrichment trace look different from the user guide?). Below is the representative trace for human TCR enrichment from PBMCs:
Creating a separate library for TRG/D is recommended. Avoid using TRG/D spike-in primers to amplify transcripts from the standard alpha-beta library. The current downstream software solution works best when there are two separate libraries for TRA/B and TRG/D cells.
Software solutions
TCR libraries enriched for TRG/D chains can be processed using cellranger multi. Use the latest version of Cell Ranger (v7.0) with the latest version of the 10x Genomics V(D)J references. Download Cell Ranger and V(D)J reference.
Inner-enrichment primers for TRG/D chains
Create a text file (.txt) containing the inner enrichment primer sequences, one primer per line. In this example, the filename is enrichment_primers.txt and its contents look like this:
CCACAATCTTCTTGGATGATCTGAGACT
GTCCCAGTCTTATGGAGATTTGTTTCAGC
Config CSV
Customize this config.csv:
[vdj]
reference-path,/path/to/vdj/reference
inner-enrichment-primers,path/to/primer/text/file/enrichment_primers.txt
[libraries]
fastq_id,fastqs,lanes,physical_library_id,feature_types,subsample_rate
the-fastq-id,/path/to/vdj-t-gd/fastqs/,7,1049511,VDJ-T-GD,
Ensure that your feature_types field is set to VDJ-T-GD. Auto-detection of feature_types does not work for TRG/D chains. Refer to the multi pipeline page for details. If your analysis includes multiple library types (e.g. VDJ-T-GD + Gene Expression), refer to the relevant example multi config CSV on the 10x Genomics Support website.
Run cellranger multi
Run cellranger multi with the newly created config file:
cellranger multi --id=<unique-id> --csv=/path/to/config.csv
Visit the 10x Genomics software support site to learn more about cellranger multi arguments.
The performance of this algorithm has been tested on human and mouse V(D)J data. Its performance with custom V(D)J references for other organisms cannot be guaranteed.
Outputs
Visit the 10x Genomics support site to learn about the web_summary.html and understand more about TRG/D outputs.
References
Zhao, Y., Niu, C. & Cui, J. Gamma-delta (γδ) T cells: friend or foe in cancer development?. J Transl Med 16, 3 (2018). https://doi.org/10.1186/s12967-017-1378-2
Products: Single Cell Immune Profiling