Question: Why do some sequence reads contain the TSO oligo at the beginning of Read 2?
Answer: A small fraction of Single Cell 3' libraries are expected to contain the template switching oligo (TSO) at the beginning of Read 2. However, if a large fraction of the library contains the TSO sequence (CCCATGTACTCTGCGTTGATACCACTGCTT) at the start of Read 2, this could indicate:
- cDNA degradation or significantly shorter cDNA than expected prior to starting the reverse transcription reaction
- Under-fragmentation during library construction and the TSO sequence was not efficiently removed from the cDNA construct during library preparation
There can also be transcript degradation as part of the normal apoptotic pathway. This would translate to intact cells, but shortened transcripts/cDNA with the TSO hybridizing very close to the polyA tail.
Products: Single Cell Gene Expression