Question: What workflow modifications are required when performing CRISPR Screening with the Single Cell Gene Expression Flex assay?
Answer: The following workflow modifications are required when performing CRISPR Screening with the Single Cell Gene Expression Flex assay.
For Step 1.1h - Perform hybridization in a thermal cycler with the following protocol.
Lid Temperature | Reaction Volume | Run Time |
42℃ | 100 µl | Overnight |
Step | Temperature | Time hh:mm:ss |
1 |
60℃ with -1℃/cycle |
00:05:00 |
2 | Go to Step 1, 17x (Total 18 cycles) | |
3 | 42℃ | Hold |
For Step 3.2 - Perform Pre-Amplification PCR that includes a TruSeq Read 2 primer. The choice of primers depends on the Flex workflow being performed.
- For Singleplexed (CG000691) and Multiplexed (CG000527) workflows, use either:
- Pre-Amp Primers B (P/N 2000529) supplemented with a user-supplied TruSeq R2 primer*, or
- Feature Pre-Amp Primers (P/N 2000515)
- For Singleplex (CG000674) and Multiplex Feature Barcode technology for Protein using Barcode Oligo Capture (CG000673) workflows, use Pre-Amp Primers C (P/N 2000953) supplemented with an additional TruSeq Read 2 primer*
- For the Singleplexed with Feature Barcode technology for Protein (CG000477) workflow, use Feature Pre-Amp Primers (P/N 2000515)
*When supplementing the Pre-Amp PCR with a user-supplied TruSeq Read 2 primer, add 2 µl of 50 µM TruSeq Read 2 primer to each pre-amp reaction.
After Step 3.3 - Following Pre-Amplification, perform an additional CRISPR Pre-Amplification PCR using TruSeq primers to further amplify CRISPR material prior to indexing.
1.) Prepare CRISPR Pre-Amplification Mix on ice. Vortex and centrifuge briefly.
CRISPR Pre-amplification Mix | P/N | 1x (µl) |
Amp Mix | 2000047 | 50 |
TruSeq R1 Primer (50 µM) | User Supplied** | 2 |
TruSeq R2 Primer (50 µM) | User Supplied** | 2 |
Nuclease-free Water | - | 26 |
**User Supplied TruSeq Primer Sequences:
- Fwd primer, TruSeq Read 1: CTACACGACGCTCTTCCGATCT
- Rev primer, TruSeq Read 2: GTGACTGGAGTTCAGACGTGTG
2.) Transfer ONLY 20 μl sample from the step Step 3.3o DNA Cleanup – SPRIselect to a new tube strip.
3.) Add 80µl CRISPR Pre-Amplification Mix to 20 µl sample. Pipette mix 5x (pipette set to 90 μl). Centrifuge briefly.
4.) Incubate in a thermal cycler with the following protocol.
Lid Temperature | Reaction Volume | Run Time |
105℃ | 100 µl | ~25 min |
Step | Temperature | Time hh:mm:ss |
1 | 98℃ | 00:00:45 |
2 | 98℃ | 00:00:20 |
3 | 63℃ | 00:00:30 |
4 | 72℃ | 00:00:20 |
5 | Go to Step 2, 7x - 9x (Total 8-10 cycles) | |
6 | 72℃ | 00:01:00 |
7 | 4℃ | Hold |
5.) Perform 1.8X SPRI cleanup (180 μl SPRIselect Reagent) and elute in 31 µl EB. Transfer 30 µl EB to a new strip tube.
For Step 4.1 - Sample Index PCR, perform the following:
- Add 50 μl Amp Mix to 30 μl sample.
- Add 20 μl of an individual Dual Index TT Set A to each sample. Pipette mix 5x (pipette set to 90 μl). Centrifuge briefly.
- Incubate in a thermal cycler using the same PCR program and cycle numbers used for Gene Expression Library Construction (Step 4.1f).
- Perform a 1.0x SPRI cleanup (100 μl SPRIselect Reagent) and elute in 41 µl EB. Wait 1 min before resuspending. Pipette mix 15x.
- Incubate 2 min at room temperature. Transfer 40 µl EB to a new strip tube.
Additional Flex + CRISPR Resources:
- For details on how to design custom probes for CRISPR Guide Capture for use with the Flex assay please see: How do I design custom probes for CRISPR Guide Capture for use with the Single Cell Gene Expression Flex Assay?
- For details on how to pool custom probe pools for a Flex + CRISPR experiment please see: How do I pool custom probes for a Single Cell Gene Expression Flex + CRISPR experiment?
- For details on how to analyze CRISPR screening and Flex data please see: How do I analyze CRISPR screening + Single Cell Gene Expression Flex data in Cell Ranger?
While no impact on assay performance is anticipated, the use of custom probes in these assays is not officially supported by 10x Genomics. The additional guidance and resources that have been provided in this article are intended to help enable these experiments and improve customer success.
Products: Single Cell Gene Expression Flex, Fixed RNA Profiling Gene Expression