Question: How do I design a custom PCR-based target enrichment assay for Single Cell 3'?
Answer: While we recommend using our hybrid/capture-based Targeted Gene Expression product to enrich Single Cell 3’ Gene Expression libraries for specific genes, it may also be feasible to implement a PCR-based target enrichment approach.
Please note that custom PCR-based target enrichment approaches have not been tested or validated by 10x Genomics, and are not supported. We are unable to provide specific experimental guidelines, and can only provide the general recommendations included here.
For PCR-based target enrichment, the cDNA amplification reaction (Protocol Step 2.2) could be modified using a partial R1 forward primer that is normally supplied in the cDNA Primer Mix (CTACACGACGCTCTTCCGATCT), together with a custom pool of gene-specific reverse primers to amplify transcripts of interest. The amplified targets would then be converted to Illumina-ready sequencing constructs by following the remaining steps in the User Guide.
Success will depend on the primer pool design and level of expression for the genes of interest. Before optimizing primer design for specific target genes, the user should run whole transcriptome sequencing with the Single Cell Gene Expression assay on typical samples and sequence to saturation. Genes with low levels of expression are not good candidates for targeted sequencing since they are unlikely to be detected at a high enough level to give adequate representation across cells in the sample.
A few notes to be aware of when developing a PCR-based target enrichment protocol:
- The number of cDNA amplification cycles, or in this case the number of "enrichment" cycles, may need to be increased by 1-2 cycles, particularly if there is a low relative abundance of the transcript of interest.
- The number of SI-PCR cycles will likely need to be increased by 1-2 cycles since the total initial mass will be significantly less.
- Depending on the length of the transcript(s) of interest, the parameters for fragmentation may need to be optimized to prevent excessive fragmentation. Fragmentation has been optimized for cDNA originating from full-length mammalian transcriptomes and thus fragmentation from a selected group of transcripts may require protocol adjustments. The length of the fragmentation reaction (5 minutes) can be increased or decreased accordingly.
Please see our the 'Oligonucleotide Sequences' within the Appendix of the User Guide for more detailed information on the Single Cell Gene Expression assay scheme.
Products: Single Cell Gene Expression