Question: What are the primer sequences for Exome Post Capture PCR?
Answer: In the 10x Genomics' Exome Demonstrated Protocol, a Post Capture PCR after Target Enrichment is necessary to prepare libraries for sequencing.
The primer sequences for the post-capture PCR are standard Illumina P5 (AATGATACGGCGACCACCGAGATCT) and P7 (CAAGCAGAAGACGGCATACGAGAT) primers, which are supplied in the Chromium Genome Library & Gel Bead Kit v2 for Exome Application. P5 and P7 primers from other vendors can be substituted at this step.
Products: Exome