Question: Can I do custom antibody oligo conjugation for the Visium CytAssist Spatial Gene and Protein assay?
Answer: It is possible to conjugate custom oligos to antibodies of interest upstream of the assay. To add user-selected oligo-tagged antibodies into the 10X Genomics Human Immune Cell Profiling Panel, please see the Custom Antibody Add-on Demonstrated Protocol (CG000664) and Pooling Workbook (CG000693) for details. At this time, there is only one 10x Genomics supported pathway for performing custom conjugation of your antibody of interest:
- Partner with BioLegend’s conjugation experts in designing and creating custom oligo-conjugated antibodies
- Contact your local BioLegend representative for more information on custom conjugation services
While 10x Genomics currently does not support custom conjugation from alternative kits or companies, there are potential conjugation kits and companies that may work. One such kit is the AlphaThera Kit oYo-Link® Oligo Custom (linked here). When performing custom conjugations, we recommend starting with an unconjugated antibody that you have verified works well with our Immunofluorescence Demonstrated Protocol (CG000659) on your FFPE tissue of interest. As these alternative approaches are not officially supported, we cannot assist with performing oligonucleotide conjugation. Furthermore, as these alternative methods are untested, assay performance cannot be guaranteed.
The oligonucleotide conjugated to the antibody on the 5’ end has to contain the sequence detailed in Table 1.
Antibody Oligonucleotide Sequence | ||
Partial TruSeq Read 2 | Antibody Barcode | Capture Sequence 1 |
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | BBBBBBBBBBBBBBB | GCTTTAAGGCCGGTCCTAGC*A*A |
Table 1. Sequence for oligonucleotide conjugated to antibody for custom antibody add-on experiments. The oligo contains at the 5' end a 34 nt Partial TruSeq Read 2 (pRead 2T), a 15 nt Antibody Barcode (indicated by “B”), and a 22 nt Capture Sequence 1 at the 3' end. The * in Capture Sequence 1 indicates a phosphorothioated bond, to prevent nuclease degradation.
Listed in the Whitelist for Custom Feature Barcoding Conjugates (CG000193) are Antibody Barcodes distinct from BioLegend TotalSeq™️-Bn barcodes that can be used in custom conjugation with alternative kits or companies. This list is shared with Single Cell applications. Please ensure to use unique Antibody Barcodes for each unique antibody conjugate.
We are currently exploring additional, fully supported, pathways for custom conjugation. Once we have other pathways that reproducibility generates quality antibody conjugates, we will include them in this article.
Products: Visium CytAssist Gene and Protein